Search Result

Pathways Recommended:	Anti-infection

Results for "

HBV infection

" in MedChemExpress (MCE) Product Catalog:

By Targets:	HBV (39) Antibiotic (1) Bacterial (1) DNA/RNA Synthesis (5) HCV (1) HIV (3) HSV (1) Influenza Virus (1) Orthopoxvirus (1) Tau Protein (1) Toll-like Receptor (TLR) (2)
By Research Areas:	Infection (42) Inflammation/Immunology (2) Neurological Disease (1)

Inhibitors & Agonists

Screening Libraries

Peptides

Natural
Products

Targets Recommended: HBV

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-145713

HBV-IN-19	HBV	Infection
HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .

HY-145713A

HBV-IN-19 TFA	HBV	Infection
HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W676876

Oxynitidine	HBV	Infection
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-P3465

Bulevirtide Myrcludex B	HBV	Infection
Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .

HY-131596

Emtricitabine triphosphate (-)-Emtricitabine triphosphate	HIV	Infection
Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427). Emtricitabine is a nucleoside reverse transcriptase inhibitor. Emtricitabine is antiretroviral agent for HIV and HBV infection .

HY-N8168

LPRP-Et-97543	HBV	Infection
LPRP-Et-97543 is a potent *anti-HBV* agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .

HY-144047

HBV-IN-16	HBV DNA/RNA Synthesis	Infection
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .

HY-144045

HBV-IN-14	HBV DNA/RNA Synthesis	Infection
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .

HY-144046

HBV-IN-15	HBV DNA/RNA Synthesis	Infection
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .

HY-156702

HBV-IN-38

HBV Infection

HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .

HBV-IN-38	HBV	Infection
HBV-IN-38 (Example 193) is an *HBV* DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-148780

HBV-IN-29	HBV	Infection
HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .

HY-122209

DVR-01	HBV	Infection
DVR-01 is a *HBV* inhibitor with EC₅₀ values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC₅₀s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases .

HY-148560

ccc_R08	HBV DNA/RNA Synthesis	Infection
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection .

HY-B0277A

Vidarabine phosphate ara-AMP; ara-A 5'-monophosphate	HBV Antibiotic	Infection
Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic *HBV* infection . Vidarabine phosphate also against herpes simplex and varicella zoster viruses .

HY-17426

Famciclovir 1 Publications Verification BRL 42810	HSV HBV	Infection
Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .

HY-145592

Ruzotolimod RO7020531; RG7854	Toll-like Receptor (TLR)	Infection
Ruzotolimod is the agonist of TLR7. Ruzotolimod has the potential for the research of HBV, COVID-19 or SARS-CoV-2 infection (extracted from patent WO2021130195A1) .

HY-147321

3'-DMTr-dG(iBu)	Tau Protein HBV	Infection Neurological Disease
3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .

HY-107902

RIG-1 modulator 1	HBV HCV HIV Influenza Virus	Infection
RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, *HBV, HCV* and HIV extracted from patent WO 2015172099 A1.

HY-109137

Selgantolimod GS-9688	Toll-like Receptor (TLR) HBV	Infection
Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection .

HY-148560B

cis-ccc_R08	HBV	Infection
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .

HY-137453B

(1R)-Tenofovir amibufenamide (1R)-HS-10234	HBV HIV	Infection
(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and *HBV* infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research .

HY-147255

Canocapavir ZM-H1505R	HBV	Infection
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .

HY-147255A

(S)-Canocapavir (S)-ZM-H1505R	Others	Infection
(S)-Canocapavir is the isomer of Canocapavir (HY-147255A). Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B .

HY-145055

HBV-IN-11

HBV Infection

HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC₅₀ of 0.46 µM (From patent WO2018085619A1, example 28) .

HBV-IN-11	HBV	Infection
HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC₅₀ of 0.46 µM (From patent WO2018085619A1, example 28) .

HY-148201

Oleana-2,12-dien-28-oic acid	HBV	Infection
Oleana-2,12-dien-28-oic acid is an *HBV-DNA* inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .

HY-P3601

Brain Derived Basic Fibroblast Growth Factor (1-24) FGF basic (1-24)	Bacterial HBV	Infection Inflammation/Immunology
Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research .

HY-13859

Clevudine L-FMAU	HBV DNA/RNA Synthesis Orthopoxvirus	Infection
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent *anti-HBV* activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .

HY-109195

Vebicorvir 1 Publications Verification ABI-H0731	HBV	Infection Inflammation/Immunology
Vebicorvir (ABI-H0731) is a first-generation *hepatitis B virus (HBV) core protein* inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC₅₀s from 1.84 μM to 7.3 μM .

HY-148560A

trans-ccc_R08	HBV	Infection
trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC₅₀ value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV) .

HY-145059

HBV-IN-12	HBV	Infection
HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC₅₀ ≤0.02 μM). From patent WO2021204252A1, compound 15 .

HY-145060

HBV-IN-13

HBV Infection

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .

HBV-IN-13	HBV	Infection
HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .

HY-145053

HBV-IN-10	HBV	Infection
HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). From patent WO2021204258A1, compound 6 .

HY-145053A

(5S,8R)-HBV-IN-10	HBV	Infection
(5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). From patent WO2021204258A1, compound 6 .

HY-111003

Isothiafludine NZ-4	HBV	Infection
Isothiafludine is an orally active non-nucleosidic anti-HBV compound. Isothiafludine inhibits hepatitis B virus replication by blocking pregenomic RNA encapsidation .

HY-149357

Yhhu6669	HBV	Infection
Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .

HY-145871

BA38017

HBV Infection

BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC₅₀ of 0.20 μM .
HY-163124

HBV-IN-43

HBV Infection

HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .

BA38017	HBV	Infection
BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC₅₀ of 0.20 μM .

HBV-IN-43	HBV	Infection
HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .

HY-W352344

2'-Deoxy-L-adenosine	HBV	Infection
2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .

HY-151134

HBV-IN-25	HBV	Infection
HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC₅₀ values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity .

Antiviral Compound Library	1270 compounds
Viruses are much simpler organisms than bacteria, and they are made from protein substances and nucleic acid. Despite the fact that the exact mechanism of infection is extremely specific to each type of virus, the general scheme of infection can be represented in the following manner: A virus is absorbed at the surface of a host cell and then permeates through the membrane, where it releases nucleic acid from its protein protection. Then the viral nucleic acid begins to replicate, and transcription of the viral genome takes place either in the cytoplasm, or in the nucleus of the host cell. As a result of these events, a large amount of viral nucleic acid and protein are made to make new generations of virions. Therefore, one mechanism of action of antiviral drugs is to interfere with the ability of a virus to get into a target cell. A second mechanism of action is to target the processes that synthesize virus components after a virus invades a cell, such as nucleotide or nucleoside analogs. MCE designs a unique collection of 1270 anti-virus compounds that target several viruses, including SARS-CoV, HBV, HCV, HIV, HSV and Influenza Virus. It’s an effective tool for anti-virus drug discovery.

Bulevirtide Myrcludex B	HBV	Infection
Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

HBV infection

Inhibitors & Agonists

Screening Libraries

Peptides

NaturalProducts

Natural
Products